Transcript: Human XM_011512589.1

PREDICTED: Homo sapiens plexin D1 (PLXND1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLXND1 (23129)
Length:
6501
CDS:
16..5403

Additional Resources:

NCBI RefSeq record:
XM_011512589.1
NBCI Gene record:
PLXND1 (23129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512589.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061548 GCCCATTACAAGATCCCTGAA pLKO.1 4543 CDS 100% 4.050 5.670 N PLXND1 n/a
2 TRCN0000061549 CCTCCCTTTATGAAGAGCGTT pLKO.1 3716 CDS 100% 2.640 3.696 N PLXND1 n/a
3 TRCN0000303674 ATGACAGTCATGGTCTATAAC pLKO_005 2149 CDS 100% 13.200 9.240 N PLXND1 n/a
4 TRCN0000381541 CCAAGTGTTCCTCCCTTTATG pLKO_005 3707 CDS 100% 13.200 9.240 N PLXND1 n/a
5 TRCN0000303743 TGTGACTCAGACTGGGAAATA pLKO_005 5484 3UTR 100% 13.200 9.240 N PLXND1 n/a
6 TRCN0000303676 CAAGAAGGTGCTCCCGGAAAT pLKO_005 4710 CDS 100% 10.800 7.560 N PLXND1 n/a
7 TRCN0000310754 CACAACTGCAGCACAAGTTTG pLKO_005 5327 CDS 100% 10.800 7.560 N PLXND1 n/a
8 TRCN0000061552 GCTTCTCAAGATCAACCTGAA pLKO.1 1494 CDS 100% 4.050 2.835 N PLXND1 n/a
9 TRCN0000299646 GCTTCTCAAGATCAACCTGAA pLKO_005 1494 CDS 100% 4.050 2.835 N PLXND1 n/a
10 TRCN0000061551 GCAAATCAACAAGGGCTCCAT pLKO.1 4194 CDS 100% 2.640 1.848 N PLXND1 n/a
11 TRCN0000061550 CCTCACGGACAACTACAACAA pLKO.1 372 CDS 100% 4.950 2.970 N PLXND1 n/a
12 TRCN0000350170 ACGGCAAGCTGGAGTACTATA pLKO_005 3983 CDS 100% 13.200 9.240 N Plxnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512589.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.