Transcript: Human XM_011512743.2

PREDICTED: Homo sapiens Kruppel like factor 15 (KLF15), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLF15 (28999)
Length:
1929
CDS:
71..1378

Additional Resources:

NCBI RefSeq record:
XM_011512743.2
NBCI Gene record:
KLF15 (28999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229891 AGTTGGGTATCTGGGTGATAG pLKO_005 181 CDS 100% 10.800 15.120 N KLF15 n/a
2 TRCN0000019833 CCCGAGTTTCCTTTGGGTGAT pLKO.1 494 CDS 100% 4.050 5.670 N KLF15 n/a
3 TRCN0000019832 GCGCTCGCACTCAGGTGTGAA pLKO.1 1243 CDS 100% 0.000 0.000 N KLF15 n/a
4 TRCN0000229894 CCAGCCGCAGAACTCATCAAA pLKO_005 1064 CDS 100% 5.625 4.500 N KLF15 n/a
5 TRCN0000019829 CAGTTGGGTATCTGGGTGATA pLKO.1 180 CDS 100% 4.950 3.960 N KLF15 n/a
6 TRCN0000229893 TGAACCTGCCCTCCAAGTTTG pLKO_005 942 CDS 100% 10.800 7.560 N KLF15 n/a
7 TRCN0000229892 CTACCCTGGAGGAGATTGAAG pLKO_005 543 CDS 100% 4.950 3.465 N KLF15 n/a
8 TRCN0000019830 CTGGAGGAGATTGAAGAGTTT pLKO.1 548 CDS 100% 4.950 3.465 N KLF15 n/a
9 TRCN0000019831 GTCTCTGAAGATGACAGCGAT pLKO.1 242 CDS 100% 2.640 1.848 N KLF15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08100 pDONR223 100% 95.5% 95.6% None 1_57del;1299C>A n/a
2 ccsbBroad304_08100 pLX_304 0% 95.5% 95.6% V5 1_57del;1299C>A n/a
Download CSV