Transcript: Human XM_011512928.3

PREDICTED: Homo sapiens poly(ADP-ribose) polymerase family member 14 (PARP14), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARP14 (54625)
Length:
5378
CDS:
151..5310

Additional Resources:

NCBI RefSeq record:
XM_011512928.3
NBCI Gene record:
PARP14 (54625)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512928.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296691 CGAGGTGTGTGTACCTATTAA pLKO_005 2822 CDS 100% 15.000 21.000 N PARP14 n/a
2 TRCN0000296754 GATTGAGTTTGATACACTTAA pLKO_005 1419 CDS 100% 13.200 18.480 N PARP14 n/a
3 TRCN0000053161 CGCATTGAAGTTGAGAACAAA pLKO.1 1948 CDS 100% 5.625 4.500 N PARP14 n/a
4 TRCN0000053160 GCCATAATTGATGCCATTGAA pLKO.1 4186 CDS 100% 5.625 3.938 N PARP14 n/a
5 TRCN0000053162 GCACCATTTGAAGAGTCACTA pLKO.1 1108 CDS 100% 4.950 3.465 N PARP14 n/a
6 TRCN0000290897 GCACCATTTGAAGAGTCACTA pLKO_005 1108 CDS 100% 4.950 3.465 N PARP14 n/a
7 TRCN0000053159 GCAGATTGTATCAGTGAGTTT pLKO.1 4732 CDS 100% 4.950 3.465 N PARP14 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5330 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5331 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512928.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.