Transcript: Human XM_011513333.3

PREDICTED: Homo sapiens syntaxin binding protein 5 like (STXBP5L), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STXBP5L (9515)
Length:
6632
CDS:
138..2102

Additional Resources:

NCBI RefSeq record:
XM_011513333.3
NBCI Gene record:
STXBP5L (9515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100432 CGAATTACTTACTGTCATCTA pLKO.1 606 CDS 100% 4.950 3.960 N Stxbp5l n/a
2 TRCN0000245784 GGTCATGCAGATGGATCAATA pLKO_005 1536 CDS 100% 13.200 9.240 N STXBP5L n/a
3 TRCN0000143953 CAGATTCACCAAGGTTGAAAT pLKO.1 6087 3UTR 100% 13.200 6.600 Y FLJ44796 n/a
4 TRCN0000144300 CCAAGGTTGAAATGAAGGAAA pLKO.1 6095 3UTR 100% 4.950 2.475 Y FLJ44796 n/a
5 TRCN0000136988 CCTCCAAGAAATATGGGACTA pLKO.1 5867 3UTR 100% 4.050 2.025 Y LOC440258 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4444 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000127836 GCATGTTCTAACCCAATGCAA pLKO.1 5612 3UTR 100% 3.000 1.500 Y LINC01949 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4445 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.