Transcript: Human XM_011513337.3

PREDICTED: Homo sapiens TSC22 domain family member 2 (TSC22D2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSC22D2 (9819)
Length:
2792
CDS:
533..2608

Additional Resources:

NCBI RefSeq record:
XM_011513337.3
NBCI Gene record:
TSC22D2 (9819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364641 GTTCCATTTGAACACGTTAAA pLKO_005 2518 CDS 100% 13.200 18.480 N TSC22D2 n/a
2 TRCN0000013519 CCGATGGACGTGTATGGAATA pLKO.1 1066 CDS 100% 10.800 15.120 N TSC22D2 n/a
3 TRCN0000369350 TCTTCCGAAGAGACGCTTAAC pLKO_005 731 CDS 100% 10.800 15.120 N TSC22D2 n/a
4 TRCN0000364564 AGCAGGAGCAGCAGCATAATC pLKO_005 2174 CDS 100% 13.200 9.240 N TSC22D2 n/a
5 TRCN0000238118 TCTGTATTCAGCATAGCTATT pLKO_005 2447 CDS 100% 10.800 7.560 N Tsc22d2 n/a
6 TRCN0000369346 TCTGTATTCAGCATAGCTATT pLKO_005 2447 CDS 100% 10.800 7.560 N TSC22D2 n/a
7 TRCN0000013520 CCACTTTCTCTCATTGCTGAA pLKO.1 2345 CDS 100% 4.050 2.835 N TSC22D2 n/a
8 TRCN0000013522 GCTTTCTACCAAGCGTTCCAT pLKO.1 2504 CDS 100% 3.000 2.100 N TSC22D2 n/a
9 TRCN0000013521 CCACTTCTGTTACTATGCCAA pLKO.1 2100 CDS 100% 2.640 1.848 N TSC22D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.