Transcript: Human XM_011513437.2

PREDICTED: Homo sapiens docking protein 7 (DOK7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOK7 (285489)
Length:
3203
CDS:
474..1970

Additional Resources:

NCBI RefSeq record:
XM_011513437.2
NBCI Gene record:
DOK7 (285489)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243957 TGCCAAGCGGATTCATCTTTG pLKO_005 558 CDS 100% 10.800 7.560 N DOK7 n/a
2 TRCN0000178900 CCAAGCGGATTCATCTTTGAA pLKO.1 560 CDS 100% 5.625 3.938 N DOK7 n/a
3 TRCN0000243960 GGACAAGTCGGAGCGTATCAA pLKO_005 196 5UTR 100% 5.625 3.938 N DOK7 n/a
4 TRCN0000180964 GATTCATCTTTGAAGGCGGGA pLKO.1 567 CDS 100% 0.540 0.378 N DOK7 n/a
5 TRCN0000243958 TACCCTGCACCTCTGCAATGA pLKO_005 457 5UTR 100% 0.000 0.000 N DOK7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16151 pDONR223 0% 57.3% 50.5% None (many diffs) n/a
2 ccsbBroad304_16151 pLX_304 0% 57.3% 50.5% V5 (many diffs) n/a
Download CSV