Transcript: Human XM_011513909.2

PREDICTED: Homo sapiens slit guidance ligand 2 (SLIT2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLIT2 (9353)
Length:
6093
CDS:
42..4541

Additional Resources:

NCBI RefSeq record:
XM_011513909.2
NBCI Gene record:
SLIT2 (9353)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312655 ACTAGAGAGACTGCGTTTAAA pLKO_005 251 CDS 100% 15.000 21.000 N SLIT2 n/a
2 TRCN0000312653 TCGCACCTTTGATGGATTAAA pLKO_005 2405 CDS 100% 15.000 21.000 N SLIT2 n/a
3 TRCN0000370127 TGCCTATCAAATCCGTGTAAA pLKO_005 2715 CDS 100% 13.200 18.480 N SLIT2 n/a
4 TRCN0000312652 TTCGGCCTCAGACGAACATAA pLKO_005 3484 CDS 100% 13.200 18.480 N SLIT2 n/a
5 TRCN0000056308 CCTGGAGAAATGGCAGATAAA pLKO.1 2616 CDS 100% 13.200 9.240 N SLIT2 n/a
6 TRCN0000370135 TGAACCTTCTCTCCCTATATG pLKO_005 1144 CDS 100% 13.200 9.240 N SLIT2 n/a
7 TRCN0000312654 TGTTGAGAAGCAATCGAATAA pLKO_005 1786 CDS 100% 13.200 9.240 N SLIT2 n/a
8 TRCN0000056310 CCTCACCTTAATTCTTAGTTA pLKO.1 2360 CDS 100% 5.625 3.938 N SLIT2 n/a
9 TRCN0000056311 CCTCCTGTATAAGGGTGACAA pLKO.1 3539 CDS 100% 4.950 3.465 N SLIT2 n/a
10 TRCN0000056312 CCTGGAGCTTTCTCACCATAT pLKO.1 900 CDS 100% 10.800 6.480 N SLIT2 n/a
11 TRCN0000363636 CCTGGAGCTTTCTCACCATAT pLKO_005 900 CDS 100% 10.800 6.480 N SLIT2 n/a
12 TRCN0000120819 GCCAACAAGATAAACTGCCTT pLKO.1 1092 CDS 100% 2.640 1.584 N Slit2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.