Transcript: Human XM_011513936.3

PREDICTED: Homo sapiens membrane associated ring-CH-type finger 6 (MARCHF6), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARCHF6 (10299)
Length:
2255
CDS:
207..2120

Additional Resources:

NCBI RefSeq record:
XM_011513936.3
NBCI Gene record:
MARCHF6 (10299)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513936.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232717 ACAACCATAGTTGGGTATATA pLKO_005 1209 CDS 100% 15.000 21.000 N MARCHF6 n/a
2 TRCN0000232719 TAATCAGCATGCTCGAAATAA pLKO_005 1967 CDS 100% 15.000 21.000 N MARCHF6 n/a
3 TRCN0000151563 GCTCGAAATAACAACGCTATT pLKO.1 1977 CDS 100% 10.800 15.120 N MARCHF6 n/a
4 TRCN0000156739 GCACCAATTTGGTTGGAGCAT pLKO.1 720 CDS 100% 2.640 3.696 N MARCHF6 n/a
5 TRCN0000152329 CAGGATGACATGAATTGGAAT pLKO.1 969 CDS 100% 4.950 3.960 N MARCHF6 n/a
6 TRCN0000232718 ATGATCCATTTGCCAATATAT pLKO_005 1608 CDS 100% 15.000 10.500 N MARCHF6 n/a
7 TRCN0000153535 CGCATCTACAAGTGCTTGTTT pLKO.1 543 CDS 100% 5.625 3.938 N MARCHF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513936.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07583 pDONR223 100% 69.4% 69.3% None 1898C>T;1900_1908delAAAAAGGCCinsT;1911_1912ins827 n/a
2 ccsbBroad304_07583 pLX_304 0% 69.4% 69.3% V5 1898C>T;1900_1908delAAAAAGGCCinsT;1911_1912ins827 n/a
Download CSV