Transcript: Human XM_011514046.2

PREDICTED: Homo sapiens myosin X (MYO10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO10 (4651)
Length:
6110
CDS:
471..4718

Additional Resources:

NCBI RefSeq record:
XM_011514046.2
NBCI Gene record:
MYO10 (4651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514046.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298630 ACTAACCTCCCAACCTGATTT pLKO_005 5134 3UTR 100% 13.200 9.240 N MYO10 n/a
2 TRCN0000123087 CCCAGATGAGAAGATATTCAA pLKO.1 2897 CDS 100% 5.625 3.938 N MYO10 n/a
3 TRCN0000286488 CCCAGATGAGAAGATATTCAA pLKO_005 2897 CDS 100% 5.625 3.938 N MYO10 n/a
4 TRCN0000123085 CCAAGGTCTTTCTTCGAGAAT pLKO.1 706 CDS 100% 4.950 3.465 N MYO10 n/a
5 TRCN0000286489 CCAAGGTCTTTCTTCGAGAAT pLKO_005 706 CDS 100% 4.950 3.465 N MYO10 n/a
6 TRCN0000123084 CCGCCTTCATTGATCCTGTAT pLKO.1 4879 3UTR 100% 4.950 3.465 N MYO10 n/a
7 TRCN0000123088 GATAGGACTTTCCACCTGATT pLKO.1 2394 CDS 100% 4.950 3.465 N MYO10 n/a
8 TRCN0000286557 GATAGGACTTTCCACCTGATT pLKO_005 2394 CDS 100% 4.950 3.465 N MYO10 n/a
9 TRCN0000123086 CCAGCTTATCAAACAGACCAA pLKO.1 3365 CDS 100% 2.640 1.848 N MYO10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514046.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.