Transcript: Human XM_011514431.3

PREDICTED: Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1A (ANKS1A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKS1A (23294)
Length:
3676
CDS:
131..3631

Additional Resources:

NCBI RefSeq record:
XM_011514431.3
NBCI Gene record:
ANKS1A (23294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323366 AGCACGAGATCCGGAACATTT pLKO_005 3204 CDS 100% 13.200 18.480 N ANKS1A n/a
2 TRCN0000130167 CCTTCTTGTCAAGTGGTTACA pLKO.1 2562 CDS 100% 4.950 6.930 N ANKS1A n/a
3 TRCN0000323287 GTGGTTATGAAGCCAATTATC pLKO_005 3012 CDS 100% 13.200 10.560 N ANKS1A n/a
4 TRCN0000128161 CCAGCAAATAGCAGCATTAAT pLKO.1 1078 CDS 100% 15.000 10.500 N ANKS1A n/a
5 TRCN0000323367 AGGAACTGACGTCAACATAAA pLKO_005 1000 CDS 100% 13.200 9.240 N ANKS1A n/a
6 TRCN0000323285 CTGTGCCAAGATGCGGAAATC pLKO_005 3085 CDS 100% 10.800 7.560 N ANKS1A n/a
7 TRCN0000130304 GAGGAAGAAGACCACATAGAT pLKO.1 1445 CDS 100% 5.625 3.938 N ANKS1A n/a
8 TRCN0000148957 GAGTGGGATGAGATTGAGAAA pLKO.1 2192 CDS 100% 4.950 3.465 N ANKS1A n/a
9 TRCN0000130726 GATATGGACCAAGATGCCCAA pLKO.1 3512 CDS 100% 2.160 1.512 N ANKS1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.