Transcript: Human XM_011514549.3

PREDICTED: Homo sapiens HIVEP zinc finger 1 (HIVEP1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HIVEP1 (3096)
Length:
9201
CDS:
480..8663

Additional Resources:

NCBI RefSeq record:
XM_011514549.3
NBCI Gene record:
HIVEP1 (3096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235474 TAGGCGTCTCAGTAGGTTTAA pLKO_005 6946 CDS 100% 13.200 18.480 N HIVEP1 n/a
2 TRCN0000237897 TGTCAATAAGTCCGGCTAATT pLKO_005 1579 CDS 100% 13.200 18.480 N HIVEP1 n/a
3 TRCN0000004980 CGAGAGTTAATGAAGCTAGTA pLKO.1 5860 CDS 100% 4.950 6.930 N HIVEP1 n/a
4 TRCN0000004978 GCGTAGTGAAACCTTGTCAAA pLKO.1 4298 CDS 100% 4.950 6.930 N HIVEP1 n/a
5 TRCN0000235475 CAATCGAGGACACCTTATAAT pLKO_005 7677 CDS 100% 15.000 10.500 N HIVEP1 n/a
6 TRCN0000235476 CATGCCGACCACAGGTTATTC pLKO_005 3029 CDS 100% 13.200 9.240 N HIVEP1 n/a
7 TRCN0000004977 CCAGGTAGTTATTTGTGTTTA pLKO.1 8940 3UTR 100% 13.200 9.240 N HIVEP1 n/a
8 TRCN0000004979 CCCAGCAAATAGTTTAGACAT pLKO.1 5753 CDS 100% 4.950 3.465 N HIVEP1 n/a
9 TRCN0000004981 CCTCCTATACAAACACTGCAT pLKO.1 1072 CDS 100% 2.640 1.848 N HIVEP1 n/a
10 TRCN0000235473 ATGTTCCACTGTTGAATATAA pLKO_005 9001 3UTR 100% 15.000 9.000 N HIVEP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.