Transcript: Human XM_011514577.3

PREDICTED: Homo sapiens inositol 1,4,5-trisphosphate receptor type 3 (ITPR3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITPR3 (3710)
Length:
8662
CDS:
48..7880

Additional Resources:

NCBI RefSeq record:
XM_011514577.3
NBCI Gene record:
ITPR3 (3710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514577.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061325 CGTGAAGAACAAGACCGACTA pLKO.1 7592 CDS 100% 4.050 5.670 N ITPR3 n/a
2 TRCN0000061326 GATGACAAGAAGAACAAGTTT pLKO.1 2334 CDS 100% 5.625 3.938 N ITPR3 n/a
3 TRCN0000333312 GATGACAAGAAGAACAAGTTT pLKO_005 2334 CDS 100% 5.625 3.938 N ITPR3 n/a
4 TRCN0000061324 CCTGCACATGAAGAGCAACAA pLKO.1 236 CDS 100% 4.950 3.465 N ITPR3 n/a
5 TRCN0000333311 CCTGCACATGAAGAGCAACAA pLKO_005 236 CDS 100% 4.950 3.465 N ITPR3 n/a
6 TRCN0000061323 CGTGTTTATCAACATCATCAT pLKO.1 6500 CDS 100% 4.950 3.465 N ITPR3 n/a
7 TRCN0000333313 CGTGTTTATCAACATCATCAT pLKO_005 6500 CDS 100% 4.950 3.465 N ITPR3 n/a
8 TRCN0000012444 CTGACCAACAAGATCGTGTTT pLKO.1 6732 CDS 100% 4.950 3.465 N Itpr3 n/a
9 TRCN0000061327 GCGTAGTGAGAAGCAGAAGAA pLKO.1 7433 CDS 100% 4.950 3.465 N ITPR3 n/a
10 TRCN0000333314 GCGTAGTGAGAAGCAGAAGAA pLKO_005 7433 CDS 100% 4.950 3.465 N ITPR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514577.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.