Transcript: Human XM_011514727.2

PREDICTED: Homo sapiens leucine rich repeat containing 1 (LRRC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC1 (55227)
Length:
2974
CDS:
245..1642

Additional Resources:

NCBI RefSeq record:
XM_011514727.2
NBCI Gene record:
LRRC1 (55227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416928 TGTACGTGACAACAGACTAAC pLKO_005 1090 CDS 100% 10.800 15.120 N LRRC1 n/a
2 TRCN0000148293 CGAAGACTAGAAGAACTTGAT pLKO.1 587 CDS 100% 4.950 3.960 N LRRC1 n/a
3 TRCN0000425732 AGACTAGAAGAACTTGATTTA pLKO_005 590 CDS 100% 13.200 9.240 N LRRC1 n/a
4 TRCN0000425844 TGGAGCCCTCTTACATCTAAA pLKO_005 646 CDS 100% 13.200 9.240 N LRRC1 n/a
5 TRCN0000433976 ACCACTTCTGTGTAGAGTTTC pLKO_005 1628 CDS 100% 10.800 7.560 N LRRC1 n/a
6 TRCN0000423844 ACTGACTAGGTTGCCAGAAAG pLKO_005 415 CDS 100% 10.800 7.560 N LRRC1 n/a
7 TRCN0000418628 AGAGTCAGTGCGATCCGATTT pLKO_005 1427 CDS 100% 10.800 7.560 N LRRC1 n/a
8 TRCN0000146591 CATATCTTCCTGACTCTCTTA pLKO.1 558 CDS 100% 4.950 3.465 N LRRC1 n/a
9 TRCN0000147640 GCAATCTTTATAACCTGGCTT pLKO.1 510 CDS 100% 2.640 1.848 N LRRC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.