Transcript: Human XM_011514837.2

PREDICTED: Homo sapiens transcription factor AP-2 beta (TFAP2B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TFAP2B (7021)
Length:
6081
CDS:
445..1854

Additional Resources:

NCBI RefSeq record:
XM_011514837.2
NBCI Gene record:
TFAP2B (7021)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415521 ACATTTGCGAAACGGAGTTTC pLKO_005 1445 CDS 100% 10.800 15.120 N TFAP2B n/a
2 TRCN0000019662 CAGTCAGTTGAAGATGCCAAT pLKO.1 1009 CDS 100% 4.050 5.670 N TFAP2B n/a
3 TRCN0000415320 GCGTACAACGGAGCAACAATA pLKO_005 2027 3UTR 100% 13.200 10.560 N TFAP2B n/a
4 TRCN0000436571 TTGGACCAGTCTGTCATTAAA pLKO_005 1048 CDS 100% 15.000 10.500 N TFAP2B n/a
5 TRCN0000428391 CAAAGCCGTCTCTGAGTATTT pLKO_005 1470 CDS 100% 13.200 9.240 N TFAP2B n/a
6 TRCN0000420505 GTTCAACTTCGAAGTACAAAG pLKO_005 1193 CDS 100% 10.800 7.560 N TFAP2B n/a
7 TRCN0000433281 TGGAGACAACCGTCCGGATTT pLKO_005 2079 3UTR 100% 10.800 7.560 N TFAP2B n/a
8 TRCN0000019659 CGGTTCTTTCGAGTTTAGTAA pLKO.1 2107 3UTR 100% 5.625 3.938 N TFAP2B n/a
9 TRCN0000019661 CTCCCGAAAGAATATGCTGTT pLKO.1 1524 CDS 100% 4.050 2.835 N TFAP2B n/a
10 TRCN0000019663 GCTGTTCACTTAGCTAGGGAT pLKO.1 1417 CDS 100% 2.640 1.848 N TFAP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.