Transcript: Human XM_011514947.2

PREDICTED: Homo sapiens tau tubulin kinase 1 (TTBK1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTBK1 (84630)
Length:
6945
CDS:
70..4062

Additional Resources:

NCBI RefSeq record:
XM_011514947.2
NBCI Gene record:
TTBK1 (84630)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148007 AGAGTGGGTCATCATCGACA pXPR_003 AGG 1663 42% 13 0.7406 TTBK1 TTBK1 75803
2 BRDN0001146632 AGAGGGACCACAGGTCGTCG pXPR_003 TGG 659 17% 8 0.4938 TTBK1 TTBK1 75802
3 BRDN0001145252 CCGCCCTCGACGGAGAGAGT pXPR_003 CGG 1981 50% 13 0.1308 TTBK1 TTBK1 75801
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037538 ACCAAAGTTGAGAGGACCTTT pLKO.1 2863 CDS 100% 4.950 3.960 N TTBK1 n/a
2 TRCN0000199433 CCTGAGCCCTTCCTCTGTAAA pLKO.1 6463 3UTR 100% 13.200 9.240 N TTBK1 n/a
3 TRCN0000037534 CCAGTTGATCATGTCAGTGTT pLKO.1 927 CDS 100% 4.950 3.465 N TTBK1 n/a
4 TRCN0000199970 CGGAACAAACTCCGGATCAAC pLKO.1 1288 CDS 100% 4.950 3.465 N TTBK1 n/a
5 TRCN0000037535 GACAGATGTCAACCGGAACAA pLKO.1 1275 CDS 100% 4.950 3.465 N TTBK1 n/a
6 TRCN0000037537 GAGGAGGATTTCGACAGCAAA pLKO.1 1696 CDS 100% 4.950 3.465 N TTBK1 n/a
7 TRCN0000200010 CCCAGGGAACATCGGTCTACT pLKO.1 4659 3UTR 100% 1.650 1.155 N TTBK1 n/a
8 TRCN0000199023 CGTCATGTCTTCCGGTGGACA pLKO.1 2913 CDS 100% 0.880 0.616 N TTBK1 n/a
9 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 2362 CDS 100% 4.950 2.475 Y PTMA n/a
10 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 2372 CDS 100% 4.050 2.025 Y Myt1 n/a
11 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 2351 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.