Transcript: Human XM_011514948.2

PREDICTED: Homo sapiens tau tubulin kinase 1 (TTBK1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTBK1 (84630)
Length:
7269
CDS:
2146..4386

Additional Resources:

NCBI RefSeq record:
XM_011514948.2
NBCI Gene record:
TTBK1 (84630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011514948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037538 ACCAAAGTTGAGAGGACCTTT pLKO.1 3187 CDS 100% 4.950 3.960 N TTBK1 n/a
2 TRCN0000199433 CCTGAGCCCTTCCTCTGTAAA pLKO.1 6787 3UTR 100% 13.200 9.240 N TTBK1 n/a
3 TRCN0000200010 CCCAGGGAACATCGGTCTACT pLKO.1 4983 3UTR 100% 1.650 1.155 N TTBK1 n/a
4 TRCN0000199023 CGTCATGTCTTCCGGTGGACA pLKO.1 3237 CDS 100% 0.880 0.616 N TTBK1 n/a
5 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 2686 CDS 100% 4.950 2.475 Y PTMA n/a
6 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 2696 CDS 100% 4.050 2.025 Y Myt1 n/a
7 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 2675 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011514948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.