Transcript: Human XM_011515481.2

PREDICTED: Homo sapiens tensin 3 (TNS3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNS3 (64759)
Length:
7415
CDS:
156..4493

Additional Resources:

NCBI RefSeq record:
XM_011515481.2
NBCI Gene record:
TNS3 (64759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230739 ACGCATAGGAGTGGTCATATC pLKO_005 491 CDS 100% 10.800 15.120 N TNS3 n/a
2 TRCN0000230740 GGTTGTAGCTCACCAGTATAG pLKO_005 1940 CDS 100% 10.800 15.120 N TNS3 n/a
3 TRCN0000002631 GTTCTGGTACAAGGCGGATAT pLKO.1 3665 CDS 100% 10.800 15.120 N TNS3 n/a
4 TRCN0000218918 GACTATGGGAAGGTTGAATTA pLKO_005 1023 CDS 100% 13.200 9.240 N TNS3 n/a
5 TRCN0000230741 CTCCCAGCAAAGCGTTCAAAC pLKO_005 2134 CDS 100% 10.800 7.560 N TNS3 n/a
6 TRCN0000002630 CCACTGTTTGCCATCATCTAA pLKO.1 5804 3UTR 100% 5.625 3.938 N TNS3 n/a
7 TRCN0000002629 GCAGCCAGAACTCACTCCTAT pLKO.1 1699 CDS 100% 4.950 3.465 N TNS3 n/a
8 TRCN0000002628 TGCCAGATAGTCCAGGTGATA pLKO.1 3607 CDS 100% 4.950 3.465 N TNS3 n/a
9 TRCN0000218987 GGACAACTACCTGGTATTAAA pLKO_005 293 CDS 100% 15.000 9.000 N TNS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.