Transcript: Human XM_011515820.2

PREDICTED: Homo sapiens ankyrin repeat and SOCS box containing 15 (ASB15), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASB15 (142685)
Length:
2973
CDS:
288..2054

Additional Resources:

NCBI RefSeq record:
XM_011515820.2
NBCI Gene record:
ASB15 (142685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148245 GCCAAATACTAGAGAATCCTT pLKO.1 1870 CDS 100% 3.000 4.200 N ASB15 n/a
2 TRCN0000149401 GCTGTTGTTCAACCCATTCAA pLKO.1 534 CDS 100% 5.625 4.500 N ASB15 n/a
3 TRCN0000149630 GCTGAGGCTATTGCTGAATAA pLKO.1 1580 CDS 100% 13.200 9.240 N ASB15 n/a
4 TRCN0000146517 CCATTGCATGAAGCTGTTGTT pLKO.1 522 CDS 100% 4.950 3.465 N ASB15 n/a
5 TRCN0000149710 GCAATGGATGAAGCTGATGAA pLKO.1 489 CDS 100% 4.950 3.465 N ASB15 n/a
6 TRCN0000149303 GCATGGTGACATCTTTGGAAA pLKO.1 1634 CDS 100% 4.950 3.465 N ASB15 n/a
7 TRCN0000148603 CCTATAAGACACTCTGGGAAT pLKO.1 583 CDS 100% 4.050 2.835 N ASB15 n/a
8 TRCN0000147262 GCACTTTGTCCTGAAAGATTT pLKO.1 378 CDS 100% 13.200 7.920 N ASB15 n/a
9 TRCN0000149041 GAAGCTGTTGTTCAACCCATT pLKO.1 531 CDS 100% 4.050 2.430 N ASB15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.