Transcript: Human XM_011515960.1

PREDICTED: Homo sapiens semaphorin 3D (SEMA3D), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA3D (223117)
Length:
6932
CDS:
351..2684

Additional Resources:

NCBI RefSeq record:
XM_011515960.1
NBCI Gene record:
SEMA3D (223117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515960.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373484 GAGTCTACAAGGAGGATATTA pLKO_005 832 CDS 100% 15.000 21.000 N SEMA3D n/a
2 TRCN0000373414 ACCTATGACCCACTGATTAAG pLKO_005 1554 CDS 100% 13.200 18.480 N SEMA3D n/a
3 TRCN0000063215 GCTCTCGATATGCTCCTACTT pLKO.1 2026 CDS 100% 4.950 6.930 N SEMA3D n/a
4 TRCN0000373413 AGAGTACTTCAGCCCTATAAC pLKO_005 747 CDS 100% 13.200 9.240 N SEMA3D n/a
5 TRCN0000063216 CCACTACATCAGAACTGACAT pLKO.1 1025 CDS 100% 4.950 3.465 N SEMA3D n/a
6 TRCN0000063214 CCTGTAGTATATGGAGTCTTT pLKO.1 1365 CDS 100% 4.950 3.465 N SEMA3D n/a
7 TRCN0000063213 GCTGCTTTCAAATAGCTGTAT pLKO.1 506 CDS 100% 4.950 3.465 N SEMA3D n/a
8 TRCN0000116340 AGAGAAGAGTTCACAGCAGGT pLKO.1 160 5UTR 100% 2.160 1.512 N LOC442331 n/a
9 TRCN0000063217 GCCCGATGAAAGAATCATCAA pLKO.1 2264 CDS 100% 0.495 0.347 N SEMA3D n/a
10 TRCN0000116320 AGAGAGAGGGAGAGAAGAGTT pLKO.1 150 5UTR 100% 4.950 2.970 N LOC442708 n/a
11 TRCN0000116337 AGAGGGAGAGAAGAGTTCACA pLKO.1 154 5UTR 100% 3.000 1.800 N LOC442331 n/a
12 TRCN0000112284 GCACACTTTCATCCACACCAT pLKO.1 2357 CDS 100% 2.640 1.584 N Sema3d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515960.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.