Transcript: Human XM_011516018.2

PREDICTED: Homo sapiens activator of transcription and developmental regulator AUTS2 (AUTS2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AUTS2 (26053)
Length:
5390
CDS:
216..3515

Additional Resources:

NCBI RefSeq record:
XM_011516018.2
NBCI Gene record:
AUTS2 (26053)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119058 CGAGACTCATCTGTTAGTAAA pLKO.1 2232 CDS 100% 13.200 10.560 N AUTS2 n/a
2 TRCN0000119059 CCTTACCGAGAACTTGACATT pLKO.1 2967 CDS 100% 4.950 3.960 N AUTS2 n/a
3 TRCN0000119061 CTTCCGTTACACCCAACTCAA pLKO.1 2035 CDS 100% 4.950 3.960 N AUTS2 n/a
4 TRCN0000300577 CTTCCGTTACACCCAACTCAA pLKO_005 2035 CDS 100% 4.950 3.960 N AUTS2 n/a
5 TRCN0000304019 ATCCTTTCAGACCTATGTTAA pLKO_005 1645 CDS 100% 13.200 9.240 N AUTS2 n/a
6 TRCN0000304080 TCATGAGCTAATGGTTCATAT pLKO_005 3924 3UTR 100% 13.200 9.240 N AUTS2 n/a
7 TRCN0000304081 TTGAGCCTGTGGTGCTTAAAG pLKO_005 583 CDS 100% 13.200 9.240 N AUTS2 n/a
8 TRCN0000331349 TAAACAAAGATCCGGAGTTAG pLKO_005 448 CDS 100% 10.800 7.560 N AUTS2 n/a
9 TRCN0000119057 CCCTTCAACTATGCAATGAAT pLKO.1 4108 3UTR 100% 5.625 3.938 N AUTS2 n/a
10 TRCN0000119060 GCCTACAACAGCAGTAGCTTA pLKO.1 891 CDS 100% 4.950 3.465 N AUTS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.