Transcript: Human XM_011516137.2

PREDICTED: Homo sapiens stimulated by retinoic acid 8 (STRA8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STRA8 (346673)
Length:
2015
CDS:
707..1846

Additional Resources:

NCBI RefSeq record:
XM_011516137.2
NBCI Gene record:
STRA8 (346673)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416260 CTGTGCAAACACTCAAGTAAA pLKO_005 1747 CDS 100% 13.200 9.240 N STRA8 n/a
2 TRCN0000435498 ACTCTCAGTCTGATCTCATAG pLKO_005 870 CDS 100% 10.800 7.560 N STRA8 n/a
3 TRCN0000128429 GAAAGAATATGCCAGCATGTA pLKO.1 1024 CDS 100% 4.950 3.465 N STRA8 n/a
4 TRCN0000129047 GAAGCTGAAAGCATCCTTCAA pLKO.1 964 CDS 100% 4.950 3.465 N STRA8 n/a
5 TRCN0000127825 GCATCCTTCAACCTGGAAGAT pLKO.1 974 CDS 100% 4.950 3.465 N STRA8 n/a
6 TRCN0000128946 CATATTCCAGAACTGGAGCAA pLKO.1 926 CDS 100% 2.640 1.848 N STRA8 n/a
7 TRCN0000130385 GAGTCATATTCCAGAACTGGA pLKO.1 922 CDS 100% 2.640 1.848 N STRA8 n/a
8 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1169 CDS 100% 4.950 2.475 Y PTMA n/a
9 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1206 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.