Transcript: Human XM_011516313.3

PREDICTED: Homo sapiens ATP binding cassette subfamily B member 4 (ABCB4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCB4 (5244)
Length:
4700
CDS:
680..4648

Additional Resources:

NCBI RefSeq record:
XM_011516313.3
NBCI Gene record:
ABCB4 (5244)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516313.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059709 GCTGGAAATCTCGCCTATTTA pLKO.1 2919 CDS 100% 15.000 21.000 N ABCB4 n/a
2 TRCN0000059711 GCAAAGATACTCTCGGCATTT pLKO.1 1652 CDS 100% 10.800 8.640 N ABCB4 n/a
3 TRCN0000424870 GTTCTTGTTGCTGCCTATATA pLKO_005 1328 CDS 100% 15.000 10.500 N ABCB4 n/a
4 TRCN0000425486 CTAACCTTGGAACTGGTATTA pLKO_005 3468 CDS 100% 13.200 9.240 N ABCB4 n/a
5 TRCN0000059712 CCCTCATCAGACAACCTCAAA pLKO.1 4371 CDS 100% 4.950 3.465 N ABCB4 n/a
6 TRCN0000059710 CGACAGGAAATAGGATGGTTT pLKO.1 1424 CDS 100% 4.950 3.465 N ABCB4 n/a
7 TRCN0000059708 GCCCACTTATTCATGCTGTTT pLKO.1 3821 CDS 100% 4.950 3.465 N ABCB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516313.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.