Transcript: Human XM_011516435.1

PREDICTED: Homo sapiens striatin interacting protein 2 (STRIP2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STRIP2 (57464)
Length:
1797
CDS:
41..1687

Additional Resources:

NCBI RefSeq record:
XM_011516435.1
NBCI Gene record:
STRIP2 (57464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446483 TGTACAGCCTTCCGCAGTATA pLKO_005 1775 3UTR 100% 13.200 18.480 N STRIP2 n/a
2 TRCN0000145390 GCTGAGTGTTATGTACCTAAT pLKO.1 646 CDS 100% 10.800 8.640 N STRIP2 n/a
3 TRCN0000416097 CCCTAAAGCAGCACAAGTATA pLKO_005 1434 CDS 100% 13.200 9.240 N STRIP2 n/a
4 TRCN0000122269 CCGAGTTGTCAGAATTGTATA pLKO.1 228 CDS 100% 13.200 9.240 N STRIP2 n/a
5 TRCN0000414204 TAAGCTTCTCCATGCATAATG pLKO_005 744 CDS 100% 13.200 9.240 N STRIP2 n/a
6 TRCN0000144412 CTACAATGAAAGGGATCTCTT pLKO.1 1111 CDS 100% 4.950 3.465 N STRIP2 n/a
7 TRCN0000143653 CTGGAGTTTGAGTATGGAGAT pLKO.1 191 CDS 100% 4.050 2.835 N STRIP2 n/a
8 TRCN0000143377 GAATGTGATTCAGAGGTCGAT pLKO.1 461 CDS 100% 2.640 1.848 N STRIP2 n/a
9 TRCN0000121875 GACATCTACAATGAAAGGGAT pLKO.1 1106 CDS 100% 2.640 1.848 N STRIP2 n/a
10 TRCN0000141806 GAGTTGGAAGAAGATGCCCAA pLKO.1 335 CDS 100% 2.160 1.512 N STRIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03824 pDONR223 100% 68% 63% None (many diffs) n/a
2 ccsbBroad304_03824 pLX_304 0% 68% 63% V5 (many diffs) n/a
Download CSV