Transcript: Human XM_011516824.2

PREDICTED: Homo sapiens collagen triple helix repeat containing 1 (CTHRC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTHRC1 (115908)
Length:
563
CDS:
108..515

Additional Resources:

NCBI RefSeq record:
XM_011516824.2
NBCI Gene record:
CTHRC1 (115908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062246 CCTGTATAATGGAATGTGCTT pLKO.1 254 CDS 100% 2.640 1.848 N CTHRC1 n/a
2 TRCN0000062247 GTGAAGGAATTGGTGCTGGAT pLKO.1 492 CDS 100% 2.640 1.848 N CTHRC1 n/a
3 TRCN0000062244 CGGGATGGATTCAAAGGAGAA pLKO.1 354 CDS 100% 4.050 2.430 N CTHRC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04689 pDONR223 100% 55.5% 51.8% None 371_372ins217;405_406ins107 n/a
2 ccsbBroad304_04689 pLX_304 0% 55.5% 51.8% V5 371_372ins217;405_406ins107 n/a
Download CSV