Transcript: Human XM_011517356.3

PREDICTED: Homo sapiens diacylglycerol O-acyltransferase 1 (DGAT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DGAT1 (8694)
Length:
1735
CDS:
177..1472

Additional Resources:

NCBI RefSeq record:
XM_011517356.3
NBCI Gene record:
DGAT1 (8694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236204 TTGAGCAATGCCCGGTTATTT pLKO_005 297 CDS 100% 15.000 21.000 N DGAT1 n/a
2 TRCN0000236205 CATCGCCTGCAGGATTCTTTA pLKO_005 210 CDS 100% 13.200 18.480 N DGAT1 n/a
3 TRCN0000036150 CTTGAGCAATGCCCGGTTATT pLKO.1 296 CDS 100% 13.200 18.480 N DGAT1 n/a
4 TRCN0000036152 CAGACACTTCTACAAGCCCAT pLKO.1 1163 CDS 100% 2.160 1.728 N DGAT1 n/a
5 TRCN0000236203 ACTACTACGTGCTCAACTATG pLKO_005 1429 CDS 100% 10.800 7.560 N DGAT1 n/a
6 TRCN0000236207 TGTGCTACGAGCTCAACTTTC pLKO_005 787 CDS 100% 10.800 7.560 N DGAT1 n/a
7 TRCN0000236206 TGTTCCTGAAGGATCCCTATA pLKO_005 373 CDS 100% 10.800 7.560 N DGAT1 n/a
8 TRCN0000036153 GAACCTCATCAAGTATGGCAT pLKO.1 323 CDS 100% 2.640 1.848 N DGAT1 n/a
9 TRCN0000036151 CATGGACTACTCACGCATCAT pLKO.1 944 CDS 100% 4.950 2.970 N DGAT1 n/a
10 TRCN0000036149 CGACTACTACGTGCTCAACTA pLKO.1 1427 CDS 100% 4.950 2.970 N DGAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.