Transcript: Human XM_011517555.2

PREDICTED: Homo sapiens chromodomain helicase DNA binding protein 7 (CHD7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHD7 (55636)
Length:
10642
CDS:
514..9594

Additional Resources:

NCBI RefSeq record:
XM_011517555.2
NBCI Gene record:
CHD7 (55636)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517555.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016410 CCGTTCAAAGATGAAATAGAT pLKO.1 6190 CDS 100% 5.625 7.875 N CHD7 n/a
2 TRCN0000234550 GAGAGTTCCAGGGAGTATAAA pLKO_005 3382 CDS 100% 15.000 12.000 N CHD7 n/a
3 TRCN0000238674 GAGAGTTCCAGGGAGTATAAA pLKO_005 3382 CDS 100% 15.000 12.000 N Chd7 n/a
4 TRCN0000016411 CGGACCATTCAGTTGTATGAA pLKO.1 3673 CDS 100% 5.625 4.500 N CHD7 n/a
5 TRCN0000234551 CTAACGTACCTAACCTATTAA pLKO_005 4220 CDS 100% 15.000 10.500 N CHD7 n/a
6 TRCN0000234552 GCCTATCAGCGCAGCTATAAA pLKO_005 6358 CDS 100% 15.000 10.500 N CHD7 n/a
7 TRCN0000238671 GCCTATCAGCGCAGCTATAAA pLKO_005 6358 CDS 100% 15.000 10.500 N Chd7 n/a
8 TRCN0000234554 GTATTGTGCAGTGCATTATTT pLKO_005 9770 3UTR 100% 15.000 10.500 N CHD7 n/a
9 TRCN0000016408 CCCTACTTACACTGTTGATAT pLKO.1 8394 CDS 100% 13.200 9.240 N CHD7 n/a
10 TRCN0000016409 GCTGCAATCATCCGTACCTTA pLKO.1 4265 CDS 100% 4.950 3.465 N CHD7 n/a
11 TRCN0000016412 CGCCAGATGTTTGATTTCCAA pLKO.1 7609 CDS 100% 3.000 2.100 N CHD7 n/a
12 TRCN0000234553 AGCGGAAAGGGAAGCTATTAT pLKO_005 6459 CDS 100% 15.000 9.000 N CHD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517555.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.