Transcript: Human XM_011517593.2

PREDICTED: Homo sapiens zinc finger homeobox 4 (ZFHX4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFHX4 (79776)
Length:
13712
CDS:
142..10992

Additional Resources:

NCBI RefSeq record:
XM_011517593.2
NBCI Gene record:
ZFHX4 (79776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274819 TGATCCATCTCGTCCATATAA pLKO_005 4746 CDS 100% 15.000 21.000 N ZFHX4 n/a
2 TRCN0000015181 CGGACAGTTCTTGCCATACTT pLKO.1 9918 CDS 100% 5.625 7.875 N ZFHX4 n/a
3 TRCN0000274880 CGGACAGTTCTTGCCATACTT pLKO_005 9918 CDS 100% 5.625 7.875 N ZFHX4 n/a
4 TRCN0000015182 GCAACGAATGTGCCACTTCTT pLKO.1 386 CDS 100% 4.950 6.930 N ZFHX4 n/a
5 TRCN0000274816 CCTGATGGGTCAGCATATATA pLKO_005 544 CDS 100% 15.000 12.000 N ZFHX4 n/a
6 TRCN0000015180 GCACAAATTCAGATGCAACTA pLKO.1 5215 CDS 100% 4.950 3.960 N ZFHX4 n/a
7 TRCN0000075528 GCTGGCAATATAGGATGGTAT pLKO.1 11140 3UTR 100% 4.950 3.960 N Zfhx4 n/a
8 TRCN0000321544 AGTTACACGTGTGGCTATAAA pLKO_005 2212 CDS 100% 15.000 10.500 N Zfhx4 n/a
9 TRCN0000274818 ATTGATATGCTGGCAATATAG pLKO_005 11132 3UTR 100% 13.200 9.240 N ZFHX4 n/a
10 TRCN0000321566 ATTGATATGCTGGCAATATAG pLKO_005 11132 3UTR 100% 13.200 9.240 N Zfhx4 n/a
11 TRCN0000015178 CCAGGATCTTTGACTTGATTA pLKO.1 7106 CDS 100% 13.200 9.240 N ZFHX4 n/a
12 TRCN0000015179 GCTGTCTAGTTTAGTAGTGAA pLKO.1 1371 CDS 100% 4.950 3.465 N ZFHX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.