Transcript: Human XM_011518131.2

PREDICTED: Homo sapiens semaphorin 4D (SEMA4D), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA4D (10507)
Length:
4656
CDS:
599..3187

Additional Resources:

NCBI RefSeq record:
XM_011518131.2
NBCI Gene record:
SEMA4D (10507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518131.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058147 GTACGGTCTTATGGGCAGAAA pLKO.1 2398 CDS 100% 4.950 6.930 N SEMA4D n/a
2 TRCN0000058146 CCTGAACTTAACATCCTTTAA pLKO.1 1009 CDS 100% 13.200 9.240 N SEMA4D n/a
3 TRCN0000058144 CGAACCAAAGATCGTCATCAA pLKO.1 2722 CDS 100% 4.950 3.465 N SEMA4D n/a
4 TRCN0000058143 GCCTGTGACTTGGTTTCTCTT pLKO.1 3350 3UTR 100% 4.950 3.465 N SEMA4D n/a
5 TRCN0000058145 GCCTGTGTTCTATGCACTCTT pLKO.1 1516 CDS 100% 4.950 3.465 N SEMA4D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518131.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07622 pDONR223 100% 99.9% 99.8% None 1775G>A n/a
2 ccsbBroad304_07622 pLX_304 0% 99.9% 99.8% V5 1775G>A n/a
Download CSV