Transcript: Human XM_011518556.3

PREDICTED: Homo sapiens crumbs cell polarity complex component 2 (CRB2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRB2 (286204)
Length:
7189
CDS:
95..3925

Additional Resources:

NCBI RefSeq record:
XM_011518556.3
NBCI Gene record:
CRB2 (286204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433100 AGGGCGTGTCTGCCGTGTTTA pLKO_005 4305 3UTR 100% 4.400 6.160 N CRB2 n/a
2 TRCN0000056129 CGTGACCTCTTCGACGCCTTT pLKO.1 3281 CDS 100% 1.350 1.080 N CRB2 n/a
3 TRCN0000438172 CGCAGCTGGCCTAACAGTATT pLKO_005 2170 CDS 100% 13.200 9.240 N CRB2 n/a
4 TRCN0000426661 TGTCTGAATGTATCTGCAATG pLKO_005 3648 CDS 100% 6.000 4.200 N CRB2 n/a
5 TRCN0000438009 TGCCACCTGCATCCCTATCTT pLKO_005 1318 CDS 100% 5.625 3.938 N CRB2 n/a
6 TRCN0000056131 GTGTGGATCTGTGGACTCATT pLKO.1 1953 CDS 100% 4.950 3.465 N CRB2 n/a
7 TRCN0000056130 ACTCGCAATGACACCAAGGAA pLKO.1 1520 CDS 100% 3.000 2.100 N CRB2 n/a
8 TRCN0000056128 CCTGTTTCAATGGTGGGACTT pLKO.1 2538 CDS 100% 4.050 2.430 N CRB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.