Transcript: Human XM_011518668.1

PREDICTED: Homo sapiens ectonucleoside triphosphate diphosphohydrolase 8 (ENTPD8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENTPD8 (377841)
Length:
1883
CDS:
227..1333

Additional Resources:

NCBI RefSeq record:
XM_011518668.1
NBCI Gene record:
ENTPD8 (377841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358612 ATCTCCTCCTACACTTCTAAT pLKO_005 98 5UTR 100% 13.200 10.560 N ENTPD8 n/a
2 TRCN0000358675 GTACTCCTTCACTGGAGAATG pLKO_005 400 CDS 100% 10.800 7.560 N ENTPD8 n/a
3 TRCN0000050075 TGGTTGGATCACTGTCAACTA pLKO.1 358 CDS 100% 4.950 3.465 N ENTPD8 n/a
4 TRCN0000050076 GCTGAACCTGACCGGGATGAT pLKO.1 1180 CDS 100% 1.650 1.155 N ENTPD8 n/a
5 TRCN0000050074 ACTCACAGCTACCTGTGCTTT pLKO.1 566 CDS 100% 0.495 0.347 N ENTPD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10076 pDONR223 100% 66.8% 66.8% None 0_1ins381;402A>G;670_780del n/a
2 ccsbBroad304_10076 pLX_304 0% 66.8% 66.8% V5 0_1ins381;402A>G;670_780del n/a
Download CSV