Transcript: Human XM_011519297.1

PREDICTED: Homo sapiens CUGBP Elav-like family member 2 (CELF2), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CELF2 (10659)
Length:
9384
CDS:
467..1921

Additional Resources:

NCBI RefSeq record:
XM_011519297.1
NBCI Gene record:
CELF2 (10659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098679 CAACAAGATGAACGGAGCTTT pLKO.1 460 5UTR 100% 4.950 6.930 N Celf2 n/a
2 TRCN0000074615 CCACTGTTGGACTGAATAATA pLKO.1 1434 CDS 100% 15.000 12.000 N CELF2 n/a
3 TRCN0000074617 GATCGGCATGAAACGCTTGAA pLKO.1 1858 CDS 100% 4.950 3.960 N CELF2 n/a
4 TRCN0000236110 AGAATGCACTGCACAATATTA pLKO_005 693 CDS 100% 15.000 10.500 N CELF2 n/a
5 TRCN0000176651 CGTTCCTGATAAGTGAATAAA pLKO.1 9064 3UTR 100% 15.000 10.500 N Celf2 n/a
6 TRCN0000236113 TTTGACCACACAGGTTAATTT pLKO_005 7521 3UTR 100% 15.000 10.500 N CELF2 n/a
7 TRCN0000074616 CCCAGAATGCACTGCACAATA pLKO.1 690 CDS 100% 13.200 9.240 N CELF2 n/a
8 TRCN0000236109 GGTTGTTGTTTCGTAACATTT pLKO_005 644 CDS 100% 13.200 9.240 N CELF2 n/a
9 TRCN0000236112 TAGGAATGGTATCGAAGAAAT pLKO_005 801 CDS 100% 13.200 9.240 N CELF2 n/a
10 TRCN0000074613 GCTCACTTTCTCATTAAGATA pLKO.1 3849 3UTR 100% 5.625 3.938 N CELF2 n/a
11 TRCN0000074614 CGCAGAGTAAAGGTTGTTGTT pLKO.1 633 CDS 100% 4.950 3.465 N CELF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.