Transcript: Human XM_011519505.1

PREDICTED: Homo sapiens myosin IIIA (MYO3A), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO3A (53904)
Length:
5375
CDS:
205..4803

Additional Resources:

NCBI RefSeq record:
XM_011519505.1
NBCI Gene record:
MYO3A (53904)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146256 CACCGTCGGAACACATCCGT pXPR_003 AGG 554 12% 7 0.6706 MYO3A MYO3A 76226
2 BRDN0001145770 TGCAGAAACATATCTAAGAG pXPR_003 GGG 2325 51% 21 -0.0247 MYO3A MYO3A 76224
3 BRDN0001148088 TCCCACTGTGTGGTCACTAG pXPR_003 AGG 1970 43% 19 -0.0830 MYO3A MYO3A 76225
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196424 GAGCCTCTAATTGCCTATATT pLKO.1 574 CDS 100% 15.000 21.000 N MYO3A n/a
2 TRCN0000002200 GCACTTTCTGACCACCCTAAT pLKO.1 415 CDS 100% 10.800 15.120 N MYO3A n/a
3 TRCN0000002199 TAGCGGTTGAATCTTAGAGAA pLKO.1 5240 3UTR 100% 4.950 6.930 N MYO3A n/a
4 TRCN0000195167 CGTGGAGCAGTTAAATCTAAT pLKO.1 3336 CDS 100% 13.200 9.240 N MYO3A n/a
5 TRCN0000195293 CTTGATCCAATTCACGATATT pLKO.1 358 CDS 100% 13.200 9.240 N MYO3A n/a
6 TRCN0000002198 CCCATTACAAACTGCCTGAAA pLKO.1 1832 CDS 100% 4.950 3.465 N MYO3A n/a
7 TRCN0000195036 CCCTAATCTATCACTTTGTTC pLKO.1 5088 3UTR 100% 4.950 3.465 N MYO3A n/a
8 TRCN0000002197 CCTGATGGATTTGTTGTCTAA pLKO.1 3003 CDS 100% 4.950 3.465 N MYO3A n/a
9 TRCN0000002201 GCGGTATTCATTCAGAGCAAA pLKO.1 4252 CDS 100% 4.950 3.465 N MYO3A n/a
10 TRCN0000226053 GGCAATGCCTGCACTATTATA pLKO_005 1624 CDS 100% 15.000 9.000 N Myo3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.