Transcript: Human XM_011519725.2

PREDICTED: Homo sapiens aldo-keto reductase family 1 member E2 (AKR1E2), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKR1E2 (83592)
Length:
1207
CDS:
380..1123

Additional Resources:

NCBI RefSeq record:
XM_011519725.2
NBCI Gene record:
AKR1E2 (83592)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046552 CACCTGCCATAAGAAGTCCTT pLKO.1 658 CDS 100% 2.640 3.696 N AKR1E2 n/a
2 TRCN0000235170 ACGAGAGCAACATGGTTATTC pLKO_005 849 CDS 100% 13.200 9.240 N AKR1E2 n/a
3 TRCN0000235169 GATCAAGGAAGGCGCTGTAAG pLKO_005 601 CDS 100% 10.800 7.560 N AKR1E2 n/a
4 TRCN0000046550 CCCAAGTCACATTAAAGAGAA pLKO.1 1179 3UTR 100% 4.950 3.465 N AKR1E2 n/a
5 TRCN0000046551 GTGTCAAACTTCAACCATGAA pLKO.1 947 CDS 100% 4.950 3.465 N AKR1E2 n/a
6 TRCN0000046549 GCTGAACTATTTGGACCTCTA pLKO.1 718 CDS 100% 4.050 2.835 N AKR1E2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12743 pDONR223 100% 68.1% 65.5% None (many diffs) n/a
Download CSV