Transcript: Human XM_011519840.3

PREDICTED: Homo sapiens eukaryotic translation initiation factor 3 subunit M (EIF3M), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EIF3M (10480)
Length:
1349
CDS:
340..1275

Additional Resources:

NCBI RefSeq record:
XM_011519840.3
NBCI Gene record:
EIF3M (10480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130186 CAGGTGTATTGTACGAGCATT pLKO.1 765 CDS 100% 4.950 6.930 N EIF3M n/a
2 TRCN0000322757 CAGGTGTATTGTACGAGCATT pLKO_005 765 CDS 100% 4.950 6.930 N EIF3M n/a
3 TRCN0000130303 GCATTTGTTATTGACGCCGTA pLKO.1 1078 CDS 100% 2.160 3.024 N EIF3M n/a
4 TRCN0000322759 CAGTGTATTGCAGCCTTATTA pLKO_005 515 CDS 100% 15.000 12.000 N EIF3M n/a
5 TRCN0000127492 CGGAAGTTACACAGAGGACAA pLKO.1 717 CDS 100% 4.050 3.240 N EIF3M n/a
6 TRCN0000130286 CTTCAGATTGGAGCTGATGAT pLKO.1 1051 CDS 100% 4.950 3.465 N EIF3M n/a
7 TRCN0000322758 CTTCAGATTGGAGCTGATGAT pLKO_005 1051 CDS 100% 4.950 3.465 N EIF3M n/a
8 TRCN0000127735 GACTGGAATCTCACCACTGAA pLKO.1 607 CDS 100% 4.950 3.465 N EIF3M n/a
9 TRCN0000322697 GACTGGAATCTCACCACTGAA pLKO_005 607 CDS 100% 4.950 3.465 N EIF3M n/a
10 TRCN0000128323 GCATTGAAAGATCCAAATGCA pLKO.1 781 CDS 100% 0.300 0.210 N EIF3M n/a
11 TRCN0000129628 CCTGTAAGATACACAGTGTAT pLKO.1 502 CDS 100% 4.950 2.970 N EIF3M n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02450 pDONR223 100% 83.1% 83.1% None 0_1ins189 n/a
2 ccsbBroad304_02450 pLX_304 0% 83.1% 83.1% V5 0_1ins189 n/a
Download CSV