Transcript: Human XM_011520349.2

PREDICTED: Homo sapiens zinc finger protein 143 (ZNF143), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF143 (7702)
Length:
3666
CDS:
839..2755

Additional Resources:

NCBI RefSeq record:
XM_011520349.2
NBCI Gene record:
ZNF143 (7702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417194 ATATCGGTGTTCGGAAGATAA pLKO_005 1726 CDS 100% 13.200 18.480 N ZNF143 n/a
2 TRCN0000012935 GCGGCCTATGTTCAACATGTA pLKO.1 1091 CDS 100% 4.950 6.930 N ZNF143 n/a
3 TRCN0000012934 CGCACTCTGTTGCTATGGTTA pLKO.1 2478 CDS 100% 4.950 3.960 N ZNF143 n/a
4 TRCN0000435073 ATTAGGGCAATACAGTAAATT pLKO_005 2975 3UTR 100% 15.000 10.500 N ZNF143 n/a
5 TRCN0000218464 ACAGGAGAAAGACCTTATTAC pLKO_005 1892 CDS 100% 13.200 9.240 N Zfp143 n/a
6 TRCN0000012933 CCTCAGAACAATGGAGCAATA pLKO.1 2757 3UTR 100% 10.800 7.560 N ZNF143 n/a
7 TRCN0000012937 GCTACAAGAGTAACTGCTAAA pLKO.1 1502 CDS 100% 10.800 7.560 N ZNF143 n/a
8 TRCN0000012936 CCACACTCATTCCAAACCTTA pLKO.1 2068 CDS 100% 4.950 3.465 N ZNF143 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.