Transcript: Human XM_011520398.3

PREDICTED: Homo sapiens family with sequence similarity 160 member A2 (FAM160A2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM160A2 (84067)
Length:
3009
CDS:
312..2918

Additional Resources:

NCBI RefSeq record:
XM_011520398.3
NBCI Gene record:
FAM160A2 (84067)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147327 GCTGAGCAACTGAAACTATTT pLKO.1 693 CDS 100% 13.200 9.240 N FAM160A2 n/a
2 TRCN0000146500 CAACCACACTTACCAGATGTT pLKO.1 521 CDS 100% 4.950 3.465 N FAM160A2 n/a
3 TRCN0000129338 CCCTTGCACTCTTCATGAGTT pLKO.1 1198 CDS 100% 4.950 3.465 N FAM160A2 n/a
4 TRCN0000128043 GAACTCCGTCTATGTCAACTT pLKO.1 2615 CDS 100% 4.950 3.465 N FAM160A2 n/a
5 TRCN0000201374 GAAGACAATTACCTGGAGTAT pLKO.1 1995 CDS 100% 4.950 3.465 N Fam160a2 n/a
6 TRCN0000149600 CCTACTTCTTCTCATGGCTTT pLKO.1 1010 CDS 100% 4.050 2.835 N FAM160A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.