Transcript: Human XM_011520446.3

PREDICTED: Homo sapiens neuron navigator 2 (NAV2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAV2 (89797)
Length:
11558
CDS:
857..8215

Additional Resources:

NCBI RefSeq record:
XM_011520446.3
NBCI Gene record:
NAV2 (89797)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149481 GCCAATCATTACCTAGCCAAA pLKO.1 1139 CDS 100% 4.050 5.670 N NAV2 n/a
2 TRCN0000149724 GCCCTTACATAATTGGCACAA pLKO.1 7497 CDS 100% 4.050 3.240 N NAV2 n/a
3 TRCN0000336791 GCCCTTACATAATTGGCACAA pLKO_005 7497 CDS 100% 4.050 3.240 N NAV2 n/a
4 TRCN0000336792 ACATCCGGACCGATGACATTA pLKO_005 3543 CDS 100% 13.200 9.240 N NAV2 n/a
5 TRCN0000147518 GCAGCATAGATTCCAACATTA pLKO.1 4560 CDS 100% 13.200 9.240 N NAV2 n/a
6 TRCN0000336790 GCAGCATAGATTCCAACATTA pLKO_005 4560 CDS 100% 13.200 9.240 N NAV2 n/a
7 TRCN0000150240 GCTGCCATTAATGGAGTAATT pLKO.1 6059 CDS 100% 13.200 9.240 N NAV2 n/a
8 TRCN0000149447 GCACCTTGATAGGAACACTTT pLKO.1 5368 CDS 100% 4.950 3.465 N NAV2 n/a
9 TRCN0000336713 GCACCTTGATAGGAACACTTT pLKO_005 5368 CDS 100% 4.950 3.465 N NAV2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.