Transcript: Human XM_011520991.2

PREDICTED: Homo sapiens RAD52 homolog, DNA repair protein (RAD52), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAD52 (5893)
Length:
3530
CDS:
142..1398

Additional Resources:

NCBI RefSeq record:
XM_011520991.2
NBCI Gene record:
RAD52 (5893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520991.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375250 TACGTGGGAGTCTGTGCATTT pLKO_005 451 CDS 100% 10.800 15.120 N Rad52 n/a
2 TRCN0000018870 CGGGTAATTAATCTGGCCAAT pLKO.1 349 CDS 100% 4.050 5.670 N RAD52 n/a
3 TRCN0000271415 ATGAACGTCATTGCGATTTAT pLKO_005 1489 3UTR 100% 15.000 10.500 N RAD52 n/a
4 TRCN0000271350 CAGCTGAAGGATGGTTCATAT pLKO_005 481 CDS 100% 13.200 9.240 N RAD52 n/a
5 TRCN0000271352 CCTCAAGTCCAAGGCTTTATC pLKO_005 534 CDS 100% 13.200 9.240 N RAD52 n/a
6 TRCN0000018874 GCAGGAGTGACTCAAGAATTA pLKO.1 1084 CDS 100% 13.200 9.240 N RAD52 n/a
7 TRCN0000271414 TCTTGGGACCTCCAAACTTAT pLKO_005 1294 CDS 100% 13.200 9.240 N RAD52 n/a
8 TRCN0000018871 CCACCAGAAACCACAAGCAAA pLKO.1 1266 CDS 100% 4.950 3.465 N RAD52 n/a
9 TRCN0000018873 GCGAAGAGACAAGATCTTGAA pLKO.1 712 CDS 100% 4.950 3.465 N RAD52 n/a
10 TRCN0000271351 ACTACCTGAGATCACTAAATA pLKO_005 650 CDS 100% 15.000 9.000 N RAD52 n/a
11 TRCN0000018872 GCACAACAGGAAACTGGGAAT pLKO.1 1328 CDS 100% 4.050 2.430 N RAD52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520991.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.