Transcript: Human XM_011521129.3

PREDICTED: Homo sapiens gamma-glutamylamine cyclotransferase (GGACT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GGACT (87769)
Length:
5619
CDS:
3208..3669

Additional Resources:

NCBI RefSeq record:
XM_011521129.3
NBCI Gene record:
GGACT (87769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521129.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265403 GCACCATGACAGCTACGACTC pLKO_005 3603 CDS 100% 0.750 1.050 N GGACT n/a
2 TRCN0000253715 CTTGGTGTTGCCGCTAGATTT pLKO_005 4018 3UTR 100% 13.200 9.240 N GGACT n/a
3 TRCN0000253713 TTCTGGATGACTTCGAGAGTT pLKO_005 3437 CDS 100% 4.950 3.465 N GGACT n/a
4 TRCN0000265409 CGGTGCAGTGCTTCGTGTACA pLKO_005 3545 CDS 100% 1.650 1.155 N GGACT n/a
5 TRCN0000253714 GCTGCGCTTTCTGGATGACTT pLKO_005 3429 CDS 100% 4.950 2.970 N GGACT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521129.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04488 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04488 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466122 TCCATCAGAACATGCTTGACACGA pLX_317 75.1% 100% 100% V5 n/a
Download CSV