Transcript: Human XM_011521378.3

PREDICTED: Homo sapiens centrosomal protein 152 (CEP152), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP152 (22995)
Length:
6271
CDS:
952..5040

Additional Resources:

NCBI RefSeq record:
XM_011521378.3
NBCI Gene record:
CEP152 (22995)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134345 GAGACTCAGATACAAGCATTA pLKO.1 1885 CDS 100% 10.800 15.120 N CEP152 n/a
2 TRCN0000137951 GCCCGAAAGATGCGCAAATAT pLKO.1 4873 CDS 100% 15.000 10.500 N CEP152 n/a
3 TRCN0000135039 CACTGAATCGTATGTGGATTT pLKO.1 2466 CDS 100% 10.800 7.560 N CEP152 n/a
4 TRCN0000137934 GCAGCCAAACTGACCAAGTAA pLKO.1 3326 CDS 100% 5.625 3.938 N CEP152 n/a
5 TRCN0000133684 GAAGAGCAAGTATTGTCCTTA pLKO.1 2062 CDS 100% 4.950 3.465 N CEP152 n/a
6 TRCN0000137997 GCATTGTTATGGGCCTCACAA pLKO.1 2033 CDS 100% 4.950 3.465 N CEP152 n/a
7 TRCN0000134042 CAAACTTGCTACAATGGCAAA pLKO.1 4971 CDS 100% 4.050 2.835 N CEP152 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.