Transcript: Human XM_011521424.3

PREDICTED: Homo sapiens leucine rich repeat containing 57 (LRRC57), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC57 (255252)
Length:
847
CDS:
130..831

Additional Resources:

NCBI RefSeq record:
XM_011521424.3
NBCI Gene record:
LRRC57 (255252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244806 ACCTCAACCAGAATCAGATAT pLKO_005 605 CDS 100% 13.200 9.240 N LRRC57 n/a
2 TRCN0000244807 TCTTGCTGTCCACGCCTTAAA pLKO_005 646 CDS 100% 13.200 9.240 N LRRC57 n/a
3 TRCN0000257095 AGAACCAGATTCGAAGTATAC pLKO_005 548 CDS 100% 10.800 7.560 N LRRC57 n/a
4 TRCN0000244805 CTAGAGACGCTAAGCCTAAAC pLKO_005 388 CDS 100% 10.800 7.560 N LRRC57 n/a
5 TRCN0000168127 GCCTTTGCTGATAGGAAAGTT pLKO.1 291 CDS 100% 5.625 3.938 N LRRC57 n/a
6 TRCN0000172794 GCTGCAAGTCATCGAACTCAA pLKO.1 585 CDS 100% 4.950 3.465 N LRRC57 n/a
7 TRCN0000172240 CTTCGAGAACTGGAAGGCTAT pLKO.1 781 CDS 100% 4.050 2.835 N LRRC57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05306 pDONR223 100% 96.1% 94.5% None (many diffs) n/a
2 ccsbBroad304_05306 pLX_304 0% 96.1% 94.5% V5 (many diffs) n/a
Download CSV