Transcript: Human XM_011521543.3

PREDICTED: Homo sapiens zinc finger protein 710 (ZNF710), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF710 (374655)
Length:
3021
CDS:
29..1882

Additional Resources:

NCBI RefSeq record:
XM_011521543.3
NBCI Gene record:
ZNF710 (374655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521543.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275274 CGCCCGTGAAGCCATTCAAAT pLKO_005 1653 CDS 100% 13.200 18.480 N ZNF710 n/a
2 TRCN0000137864 GAACAGGAGGTCTATGAGGTT pLKO.1 380 CDS 100% 2.640 3.696 N ZNF710 n/a
3 TRCN0000275277 CTACTGCTCCAGCAAGTTTAA pLKO_005 1762 CDS 100% 13.200 9.240 N ZNF710 n/a
4 TRCN0000275278 GCTCTTTGGAGCTACCATAAG pLKO_005 124 CDS 100% 10.800 7.560 N ZNF710 n/a
5 TRCN0000136453 CTCAAGACCCACATGATTGTA pLKO.1 1628 CDS 100% 5.625 3.938 N ZNF710 n/a
6 TRCN0000138949 GAAGTCCTTCAACCGCATGTA pLKO.1 1687 CDS 100% 4.950 3.465 N ZNF710 n/a
7 TRCN0000282020 GAAGTCCTTCAACCGCATGTA pLKO_005 1687 CDS 100% 4.950 3.465 N ZNF710 n/a
8 TRCN0000138664 CAAGGTCAAGTTCGAGAAGGT pLKO.1 349 CDS 100% 2.640 1.848 N ZNF710 n/a
9 TRCN0000138075 GTCCTACACGTCCAAGTACAA pLKO.1 934 CDS 100% 4.950 2.970 N ZNF710 n/a
10 TRCN0000138550 CACGAAGTGAAGCATGAGAGT pLKO.1 1217 CDS 100% 2.640 1.584 N ZNF710 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521543.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.