Transcript: Human XM_011521960.3

PREDICTED: Homo sapiens transcription factor 12 (TCF12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCF12 (6938)
Length:
4575
CDS:
641..2797

Additional Resources:

NCBI RefSeq record:
XM_011521960.3
NBCI Gene record:
TCF12 (6938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274222 CTTACGCGTGCGGGATATTAA pLKO_005 2509 CDS 100% 15.000 21.000 N TCF12 n/a
2 TRCN0000015171 CCATCCCATAATGCACCAATT pLKO.1 2060 CDS 100% 10.800 15.120 N TCF12 n/a
3 TRCN0000274168 CCATCCCATAATGCACCAATT pLKO_005 2060 CDS 100% 10.800 15.120 N TCF12 n/a
4 TRCN0000274170 CTCGAATGGAGGATCGTTTAG pLKO_005 1941 CDS 100% 10.800 15.120 N TCF12 n/a
5 TRCN0000274220 TACCAACCCTATGGGTCATAT pLKO_005 2773 CDS 100% 0.000 0.000 N TCF12 n/a
6 TRCN0000015169 CCCACAATTCTTCTGACCTTT pLKO.1 1368 CDS 100% 4.950 3.465 N TCF12 n/a
7 TRCN0000015172 GCAATCATTCAGTCCTGTCTA pLKO.1 2181 CDS 100% 4.950 3.465 N TCF12 n/a
8 TRCN0000015170 CCACCTGTTAATAGTGGGAAA pLKO.1 725 CDS 100% 4.050 2.835 N TCF12 n/a
9 TRCN0000075505 GCCGAATGTGTCAGCTTCATT pLKO.1 2550 CDS 100% 5.625 3.938 N Tcf12 n/a
10 TRCN0000075506 CCTTCATCAGATGACATGAAA pLKO.1 2345 CDS 100% 0.563 0.394 N Tcf12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07037 pDONR223 100% 98.2% 98.3% None 135A>G;149_184del n/a
2 ccsbBroad304_07037 pLX_304 0% 98.2% 98.3% V5 135A>G;149_184del n/a
Download CSV