Transcript: Human XM_011522160.2

PREDICTED: Homo sapiens diphthamine biosynthesis 6 (DPH6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DPH6 (89978)
Length:
852
CDS:
53..817

Additional Resources:

NCBI RefSeq record:
XM_011522160.2
NBCI Gene record:
DPH6 (89978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242719 CCCTCTATCGCCGAACCATAA pLKO_005 255 CDS 100% 10.800 15.120 N DPH6 n/a
2 TRCN0000242721 GGAAGGACAGCTGCTATAATA pLKO_005 81 CDS 100% 15.000 10.500 N DPH6 n/a
3 TRCN0000257161 AGATCGTTGCTTTAGCAAATC pLKO_005 129 CDS 100% 10.800 7.560 N DPH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04502 pDONR223 100% 94.7% 93.6% None 752_752delGins22;760G>T;762_762delAinsTAATTATATATATAATTTT n/a
2 ccsbBroad304_04502 pLX_304 0% 94.7% 93.6% V5 752_752delGins22;760G>T;762_762delAinsTAATTATATATATAATTTT n/a
3 TRCN0000467870 GACCCTCCCGTTTGTGAAGTCACG pLX_317 42.6% 94.7% 93.6% V5 752_752delGins22;760G>T;762_762delAinsTAATTATATATATAATTTT n/a
Download CSV