Transcript: Human XM_011522177.2

PREDICTED: Homo sapiens Src homology 2 domain containing F (SHF), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHF (90525)
Length:
1902
CDS:
16..1008

Additional Resources:

NCBI RefSeq record:
XM_011522177.2
NBCI Gene record:
SHF (90525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265424 AGCCGCAAGCTACCCATTAAG pLKO_005 1098 3UTR 100% 13.200 18.480 N SHF n/a
2 TRCN0000253647 AGCTGGAGATTCCTTAATTTA pLKO_005 1292 3UTR 100% 15.000 10.500 N SHF n/a
3 TRCN0000253649 CTGAAATTGTGCACCACTATG pLKO_005 1075 3UTR 100% 10.800 7.560 N SHF n/a
4 TRCN0000253648 AGTGGAAGAAGGAGCGGATTT pLKO_005 827 CDS 100% 10.800 6.480 N SHF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14335 pDONR223 100% 24.9% 15.9% None (many diffs) n/a
2 ccsbBroad304_14335 pLX_304 0% 24.9% 15.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479544 TGCATACGTCCCTATATTCGCGTC pLX_317 44.8% 24.9% 15.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV