Transcript: Human XM_011522766.3

PREDICTED: Homo sapiens intraflagellar transport 140 (IFT140), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IFT140 (9742)
Length:
4732
CDS:
73..4215

Additional Resources:

NCBI RefSeq record:
XM_011522766.3
NBCI Gene record:
IFT140 (9742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148378 CCAAGGAAACATCACGCAAAT pLKO.1 1203 CDS 100% 10.800 15.120 N IFT140 n/a
2 TRCN0000131159 GTGGAGTCAAACCGAGTTCAA pLKO.1 1561 CDS 100% 4.950 6.930 N IFT140 n/a
3 TRCN0000149138 GACTAATAAGAGCCACCTCTT pLKO.1 1719 CDS 100% 0.405 0.324 N IFT140 n/a
4 TRCN0000414916 CAACAGGCAGCGTGGATATTT pLKO_005 188 CDS 100% 15.000 10.500 N IFT140 n/a
5 TRCN0000424583 TAATGAGCAAGAGACTAATAA pLKO_005 1707 CDS 100% 15.000 10.500 N IFT140 n/a
6 TRCN0000432199 TAGAACGAGGAGAGAATTATA pLKO_005 986 CDS 100% 15.000 10.500 N IFT140 n/a
7 TRCN0000147721 GAAAGGCATCTTCTGGAATTT pLKO.1 4250 3UTR 100% 13.200 9.240 N IFT140 n/a
8 TRCN0000147132 CACATTGTAAAGCCTGAGAAA pLKO.1 4501 3UTR 100% 4.950 3.465 N IFT140 n/a
9 TRCN0000128017 GAAGAACATCATCGGCTTCTA pLKO.1 3624 CDS 100% 4.950 3.465 N IFT140 n/a
10 TRCN0000130651 CAGAAAGGCATCTTCTGGAAT pLKO.1 4248 3UTR 100% 0.495 0.347 N IFT140 n/a
11 TRCN0000085531 GAGTTCAAGTTCGAACCTGAA pLKO.1 1574 CDS 100% 4.050 2.430 N Gata5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02233 pDONR223 100% 94.3% 94.3% None 1522_1523ins246 n/a
2 ccsbBroad304_02233 pLX_304 0% 94.3% 94.3% V5 1522_1523ins246 n/a
Download CSV