Transcript: Human XM_011522842.2

PREDICTED: Homo sapiens adenylate cyclase 7 (ADCY7), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCY7 (113)
Length:
6306
CDS:
416..3676

Additional Resources:

NCBI RefSeq record:
XM_011522842.2
NBCI Gene record:
ADCY7 (113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365428 CTTTATCGGTGACAAGTTAAA pLKO_005 2995 CDS 100% 13.200 18.480 N ADCY7 n/a
2 TRCN0000365360 GTGGCCTGATCAACGTCAAAG pLKO_005 3585 CDS 100% 10.800 15.120 N ADCY7 n/a
3 TRCN0000370534 GTGTTCGACGCATGGACAAAG pLKO_005 749 CDS 100% 10.800 15.120 N ADCY7 n/a
4 TRCN0000078352 TGCCCACTTTATCGGTGACAA pLKO.1 2989 CDS 100% 4.950 6.930 N ADCY7 n/a
5 TRCN0000365358 TCTCCAGACAGATTGACTATT pLKO_005 2853 CDS 100% 13.200 10.560 N ADCY7 n/a
6 TRCN0000078348 CCGTCCTTCAACTGTATCTTA pLKO.1 4602 3UTR 100% 5.625 4.500 N ADCY7 n/a
7 TRCN0000078349 GCCGGACTTCAAAGTGTTCTA pLKO.1 3070 CDS 100% 4.950 3.960 N ADCY7 n/a
8 TRCN0000370608 ACAGAGGCATTCTGGTAAATG pLKO_005 4151 3UTR 100% 13.200 9.240 N ADCY7 n/a
9 TRCN0000078350 CTCCAGACAGATTGACTATTA pLKO.1 2854 CDS 100% 13.200 9.240 N ADCY7 n/a
10 TRCN0000370607 GTACGGACACTGCCAAGTTTC pLKO_005 3636 CDS 100% 10.800 7.560 N ADCY7 n/a
11 TRCN0000078351 CCACTTTATCGGTGACAAGTT pLKO.1 2992 CDS 100% 4.950 3.465 N ADCY7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.