Transcript: Human XM_011522865.1

PREDICTED: Homo sapiens zinc finger CCCH-type containing 18 (ZC3H18), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZC3H18 (124245)
Length:
2169
CDS:
26..1504

Additional Resources:

NCBI RefSeq record:
XM_011522865.1
NBCI Gene record:
ZC3H18 (124245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233041 CCTTACGCAGACCCTTATTAT pLKO_005 7 5UTR 100% 15.000 21.000 N ZC3H18 n/a
2 TRCN0000075171 GTTGAATAAGGCGGCTGATAA pLKO.1 1102 CDS 100% 13.200 18.480 N ZC3H18 n/a
3 TRCN0000075168 CCAGCACGGTTCTCATGTAAA pLKO.1 1738 3UTR 100% 13.200 9.240 N ZC3H18 n/a
4 TRCN0000233042 GTCAGCCTCTGCCTCTAATTC pLKO_005 283 CDS 100% 13.200 9.240 N ZC3H18 n/a
5 TRCN0000075170 CTGTTGAATAAGGCGGCTGAT pLKO.1 1100 CDS 100% 4.050 2.835 N ZC3H18 n/a
6 TRCN0000075169 CGCAGACCCTTATTATGACTA pLKO.1 12 5UTR 100% 4.950 2.970 N ZC3H18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09481 pDONR223 100% 51.6% 48.2% None 0_1ins1114;92_93ins269 n/a
2 ccsbBroad304_09481 pLX_304 0% 51.6% 48.2% V5 0_1ins1114;92_93ins269 n/a
Download CSV