Transcript: Human XM_011523028.2

PREDICTED: Homo sapiens carboxylesterase 4A (CES4A), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CES4A (283848)
Length:
2498
CDS:
157..1887

Additional Resources:

NCBI RefSeq record:
XM_011523028.2
NBCI Gene record:
CES4A (283848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423046 GAGTCTGTACCAGTCTCAAAG pLKO_005 1842 CDS 100% 10.800 15.120 N CES4A n/a
2 TRCN0000046748 GCACCGCGTTATTCAGACTTT pLKO.1 944 CDS 100% 4.950 6.930 N CES4A n/a
3 TRCN0000046750 CCTCAAGTGGTCACCAAATAT pLKO.1 268 CDS 100% 15.000 10.500 N CES4A n/a
4 TRCN0000424402 AGTACCTGGACAATGTCAATG pLKO_005 1400 CDS 100% 10.800 7.560 N CES4A n/a
5 TRCN0000416650 GTGTCCAACAAGATGAGATTC pLKO_005 1087 CDS 100% 10.800 7.560 N CES4A n/a
6 TRCN0000046749 CGAAACCGTATGATGGACATA pLKO.1 1441 CDS 100% 4.950 3.465 N CES4A n/a
7 TRCN0000046751 GAAGGTTTCATCTGTGCCCTA pLKO.1 1215 CDS 100% 2.160 1.512 N CES4A n/a
8 TRCN0000421795 CAATTGGCTCTTGCCTTATAA pLKO_005 1263 CDS 100% 15.000 10.500 N CES4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.