Transcript: Human XM_011523046.3

PREDICTED: Homo sapiens bromodomain containing 7 (BRD7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRD7 (29117)
Length:
3853
CDS:
196..2205

Additional Resources:

NCBI RefSeq record:
XM_011523046.3
NBCI Gene record:
BRD7 (29117)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523046.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158342 CAAACACCTCTACGAGGAGTA pLKO.1 228 CDS 100% 4.050 5.670 N BRD7 n/a
2 TRCN0000360087 TATGTCATGGCAGATAGTTTA pLKO_005 1615 CDS 100% 13.200 10.560 N BRD7 n/a
3 TRCN0000360145 TATGGGCCCTACAGTTCTTAT pLKO_005 1456 CDS 100% 13.200 9.240 N BRD7 n/a
4 TRCN0000151543 GAAGACACTGAAGAACCTAAA pLKO.1 2146 CDS 100% 10.800 7.560 N BRD7 n/a
5 TRCN0000151186 GCAGATAGTTTACTGGATGTT pLKO.1 1624 CDS 100% 4.950 3.465 N BRD7 n/a
6 TRCN0000154102 CCAAGTGATTTCAGCATCCAT pLKO.1 1564 CDS 100% 3.000 2.100 N BRD7 n/a
7 TRCN0000151378 GCTGAACAAGTGACCAATAAT pLKO.1 2005 CDS 100% 15.000 9.000 N BRD7 n/a
8 TRCN0000360144 GAATCAACTGATGAGACAATT pLKO_005 666 CDS 100% 13.200 7.920 N BRD7 n/a
9 TRCN0000158368 CAGCAAGTAACTCCAGGTGAT pLKO.1 2041 CDS 100% 4.050 2.430 N BRD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523046.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.